Human Variation and Race blog

1. High levels of solar radiation negatively impacts the survival of humans by disturbing homeostasis. If too much ultraviolet radiation hitting one’s skin can cause the breakdown of one of the B vitamins- folate, which may result in anemia. Women who don’t have enough folic acid are at a higher risk of having miscarriages or babies with neural tube defects. Folate is also essential for DNA replication in the process of dividing cells, so a lack of it may result in the reduction of production of sperm cells. Also, the more sunlight children are exposed to, the greater chance they will develop multiple sclerosis. It also obviously causes skin cancer. Having dark skin in northern latitudes can prevent people from producing enough vitamin D and can result in rickets disease in kids and osteoporosis in adults.
2. An example of a short term adaptation humans have to cope with high levels of solar radiation is perspiration. One loses heat through many sweat glands in evaporative cooling. Perspiration is considered to be the “most important factor in heat dissipation” according to the book.

An example of a facultative adaptation is acclimatization including tanning. The physiological responses to this environmental stress is influenced to an extent by genetic factors, as well as other factors like duration and severity of the exposure. The simplest form of acclimatization is tanning, which is a temporary and quick environmental change adjustment that returns back to the original skin tone over time when exposure to sunlight is reduced.

An example of a developmental adaptation is the presence of the pigment called melanin. The number and size of melanin particles as well as the percentages of different kinds of melanin determine skin color. If someone has a higher percentage of pheomelanin their skin will probably be more red to yellow color, and those who have a higher percentage of eumelanin will probably be more dark brown to black colored.

Examples of cultural adaptations are sunglasses, hats, clothes and sunscreen. Before people spend a day in the sun, they will usually apply sunscreen to prevent or reduce risk of skin damage and tanning. People also wear sunglasses, hats and extra clothing (beach cover-up) to protect themselves from solar radiation.

3. It is beneficial to study human variations from this perspective across environmental clines because it helps to show why certain people have health problems, or are healthier than others or have the skin tone they do, or why it is beneficial to have the skin tone that they do. By looking at the clines of solar radiation (where melanin is protective) versus clines of solar vitamin D absorption (where melanin is not protective) it shows that in areas where UV protection is needed, skin color is darker, and where people need more vitamin D more than they need UV protection, their skin is lighter. By using UV radiation as a factor in studies like malnutrition among children indicating high frequencies of rickets disease, or vitamin D related to healthy pregnancies, it can be useful to figure out that certain people need more vitamin D, or need to be in the sun less or more to be healthier. In a study published in the Journal of Nutrition, researchers found that prenatal vitamins should contain higher doses of vitamin D, especially in the northern US. 16% of African Americans and 53% of European Americans had enough vitamin D in their bodies at the end of their pregnancies. Therefore, the information that was gathered from UV rays’ connection with vitamin D, and anthropological studies became the basis of further research for human nutrition and pregnancy.
4. Race is influenced by levels of solar radiation, especially in the developmental adaptation of the presence of melanin. Race is the result of the adaptations, especially those that are genetic and longer lasting. Race is the result of different environmental clines and the different makeup of melanin in individuals. It is one of the many adaptations to deal with high levels of solar radiation. The study of environmental influences on adaptations is a better way to understand human variation than by the use of race because race is the result of many different adaptations. These adaptations are what is a key to these major variations and changes in the appearance and makeup of humans. Environmental influences are what must be studied in order to learn about why there is variation among humans, especially skin color. It is interesting to learn why there is variation, because it shows that our bodies are influenced by many simple things that we wouldn’t even think of like the sun or altitude.

Language

When I was unable to use symbolic language, like no speaking or typing, I found it to be difficult. I had to keep thinking of new ways to convey certain emotions and phrases I wanted to say.My partner had to do all of the talking, and he tried to ask me yes/no questions so we could still have a conversation. Instead of asking how work went for me, he asked if work was hard or long or good or bad. He was laughing a lot because it was weird that I wasn't being vocal in the conversation, and couldn't contribute to the flow of the conversation at all either. I had to depend on him to do all the talking and communicating. The culture who uses symbolic language has the advantage in communicating complex ideas. The speaking culture might think the other culture is less intelligent since they use only physical embellishments to communicate instead of voice, which is simpler. Some individuals in our culture who have difficulty communicating with spoken language are mute people, deaf people, people with brain damage after accidents, and people with mental disabilities. It affects how these individuals interact with others because they have to use physical actions instead of just talking to communicate. They use sign language with their hands, motions, pointing, writing, or voice output communication aids. Therefore, they have to work twice as hard to communicate in very creative ways.

I was not able to last the full 15 minutes of communicating without any physical embellishments. It made it difficult because once I could no longer use vocal intonation, I would think to turn to signals, or body movements to convey what I wanted to say. Therefore, I had to think of even more clever ways to communicate. It was also hard to keep a monotone voice and not change my vocal intonation. My partner found it amusing with the way I was talking. I was talking to my boyfriend, and he showed me a picture of us on his phone and instead of me smiling and being like "Awe!", I had to say, "Awe. That's. so. cute." completely emotionless. It made it difficult for him to figure out how I felt because I was expressionless. He didn't know if I was tired, or bored or didn't want to talk to him, which was kind of funny. This experiment clearly exemplifies that non-speech language techniques are almost essential in our ability to communicate effectively. It is impossible to tell what someone feels if they do not convey emotion. Saying "I love you" with no vocal intonation wouldn't be meaningful. Saying "I love you" with a gentle, loving tone and perhaps a hug conveys so much more. Therefore, non-speech language techniques bring to life feeling and emotion, and bring meaning to a conversation.

There are definitely some people who have difficulty reading body language. Knowing how to read body language is an important adaptive benefit because it can save you from bad, uncomfortable, and avoid-worthy situations. For example, if you are walking along the street and see a dog coming towards you with narrowed eyes, showing their teeth, and anxious, as if they're ready to pounce, if you understood their body language, you would run the other way. If you didn't know, you might try to pet the dog or get closer, and end up getting bitten and/or attacked. An environmental condition where there could be a benefit to not read body language is in a classroom. Some students who cross their arms, wear their sweatshirt hoods, refuse to make eye contact, or look down may be some of the brightest students in the class. They just might not like speaking to the entire class, or are very shy. By not reading their body language and calling on them, you might be shocked by the fact that they are in tune with the class, and do have something thoughtful to say. The same goes with people who are exhibiting those same shy/reserved body languages. Talking to someone like that could make their day. Maybe they're too shy to make friends or initiate a conversation, but by talking to them, they could gain a new friend. Another environmental condition where it would be beneficial to not read body language would be if a band was performing to a crowd of people who look bored. If the band pays attention to the body language, they might get upset or angry and stop trying very hard. If they push through and focus on putting on the best show ever and remain positive, they could gain fans. Plus, Some bored looking fans may just be too exhausted to rock out.

Piltman Hoax

In early 1912, a laborer found a piece of skull when he was digging at Barkham Manor near the village of Piltdown in England. He then passed it on to amateur archaeologist, Charles Dawson, who passed on the news of discovering a part of a human skull to geologist, Sir Arthur Smith Woodward. Dawson claimed that the skull would “rival the German’s ape man”. After a summer of digging, they found an ape-like jawbone with human-like teeth, which seemed to connect to the skull Dawson had been given. The discovery was announced on December 18, 1912, named Piltdown Man or “the earliest Englishman”. It was accepted by the general public as it was proof of Charles Darwin’s theory that humans were connected to apes. It was proof of the earliest human. However, some scientist questioned its validity because part of the jaw was broken off, so there was no way to show if the jawbone truly fit the piece of skull. The canine tooth was absent. A year later, a canine tooth was miraculously found, which silenced those who were doubtful. This discovery was aided by Dawson, Woodward and priest, Teilhard de Chardin. The Natural History Museum and even Winston Churchill backed these discoveries. In 1953, the Piltdown hoax was announced. In the museum, Kenneth Oakley did a test to authenticate and date the fossils, which showed that Piltdown Man was much younger than expected. In the mineral department, tests were carried out to estimate the nitrogen content, which revealed that the skull had been stained and the teeth had been filed down. It was an old ape jawbone. The fossils were boiled and stained with chemicals to give them an aged look. The canine was filed and painted. There were several suspects who could have been responsible for the hoax. Conan Doyle, who created Sherlock Holmes, lived close to Piltdown and was in the same social circle as Dawson. He told Dawson he was excited about his finds, but scientists mocked him for his photographs of “spirits”, which made him upset. In his book, The Lost World, many things he wrote were parallel to the story such as saying “a bone can be as easily faked as a photograph”. He never admitted because he was engaged in political talk and trying to influence the British government in the conduct of war, so that would have been the wrong time to talk about such a thing. Charles Dawson is an obvious suspect, and had a personality of getting everything he went after. Other artifacts he claimed to discover were also fake. Woodward was Dawson’s number one supporter, but he didn’t even test the jaw for nitrogen content or spot signs of forgery like the filed teeth, even though he was the most eminent scientist at the museum. Martin Hinton, head of the paleontology department, was always skeptical of the Piltdown’s authenticity and some found stained and colored bones in an old one of his trunks, which looked similar to the staining and coloring of the Piltdown finds. Kenneth Oakley, who took part in discovering the hoax was also accused. He believed Martin Hinton was the one behind the hoax.
Charles Dawson longed to find the first Englishman, since other countries such as France and Germany had long before discovered their early men. Things such as “egotism, pride, ambition and rivalry” can affect scientific judgments. Furthermore, those behind the Piltdown find did not take a close look at what they found or do tests on them to see if they were authentic or what they claimed to be. If they had spent more time analyzing what they found, or just holding up a magnifying glass to the teeth or bones, instead of jumping to conclusions, they would have been able to tell it wasn’t what they thought it was. Also, the fact that the hoax was not discovered earlier shows that other scientists removed from the situation did not try to verify their findings, they simply decided to accept them (or at least many did). It took over 40 years for them to have enough doubt to investigate it throughougly, which is a huge flaw.

As I said above, on behalf of the Natural History Museum, tests were carried out to estimate the nitrogen content, which revealed that the skull had been stained and the teeth were filed down. Kenneth Oakley did a nitrogen test, to authenticate and date the fossils which showed that Piltdown man was far younger than he was supposed to be. They also discovered that the fossils were boiled and stained with chemicals to make them look older. Even by using a magnify glass, Dawson could have seen the teeth were filed down. Therefore, the technology and investigation of scientists showed the positive aspects of the scientific process, exemplifying how talented and observant such scientists can be.
It is not possible to remove the human factor from science, because a human has to interpret data and finding. Science is not only findings and research. It is connecting those findings and discoveries to other ideas and concepts and theories. Charles Darwin’s natural selection theory grew off of other scientists’ findings and discoveries, as well as other scientists’ theories and ideas. We can’t learn about the world simply by looking at a bone, we need professionals to analyze it and connect it to other ideas. There will always be chances in error, which is why every scientific idea is called a theory- it cannot be proven. I would not want to remove the human factor from science as I believe it is essential. If every theory is looked into thoroughly before it becomes a huge idea that people set as a basis for other ideas, then we will decrease chances for error like the Piltdown man hoax.
This historical event shows that you should never be so gullible as to accept such huge information or ideas from unverified sources. You need to thoroughly investigate everything if such a huge idea is presented. Scientists mainly stayed quiet, even the Museum, instead of looking into the discovery from the beginning when people were having doubts. It doesn’t matter if you have many credible geologists on your side, there is no harm in questioning and verifying facts before deciding that if it is credible and reliable.

Comparative Primate Blog

Chimpanzees
Chimpanzees spend an equal amount of time on land and in trees, but they spend most of their eating and sleeping time in the forest canopy. They inhabit a variety of wooded habitats across equatorial Africa such as evergreen forests, woodlands, grasslands, savannas, tropical rain forests, and swamp forests.

Chimpanzee dentition is 2:1:2:3. It includes two incisors, one enlarged canine, two premolars, and three molars. Their muzzle is shorter and flatter than most other primates.

Chimpanzees’ teeth are used for a variety of reasons. They use them to eat food like fruits, leaves, palm-nuts, seeds, and meat. They use their canine teeth to grab their prey and flail it to death on the ground, or against a tree limb. They also use their teeth to extract ants and termites.

Spider Monkeys

Spider monkeys live in areas that have large tracts of moist evergreen forests, and undisturbed rainforests. They are particularly found in the tropical forests of Central and South America, from the southern part of Mexico to Brazil. They live in bands of up to 35 other spider monkeys who forage together during the day. They are also diurnal, and sleep during the night in trees that have been carefully selected.

Their dentition is 2:1:3:3. They have big incisors and small molars, with three upper premolars that have one to two cusps. A diastema separates the upper canines from the upper incisors. There are also three bottom premolars that have 2-3 cusps.

Their four large incisors and small molars exemplify the spider monkeys’ frugivorous diet which consists of mostly fruits and nuts. Sometimes they will also eat leaves and flowers, and if food is low, they will eat insects, bark, and honey. They eat fruits from large forest trees, which they can swallow whole. Spider monkeys are hunted by humans, and are also threatened by logging and land clearing. Therefore, their teeth are adapted to eating many different types of food, and are adapted to easily get more difficult food such as bark, honey, and insects. Their molars help them to chew harder food like nuts.

Baboons
Baboons are terrestrial, and live in locations where there are water sources and safe places to sleep, such as tall trees or cliff faces. They are found in savannas, woodlands, open savannah, open woodland, and hills across Africa.

Baboons’ dentition is 2:1:2:3 and consists of sexually dimorphic canines. They have long lower premolars, which sharpen their large canines. They also have geladas which have complex enamel folding in their molars.

Baboons use their sharp molars to hunt for food like insects, fish, shellfish, birds, and small antelpoes. They forage throughout the day and night and their teeth can be very useful for eating and killing a wide variety of prey, even including sheep or goats.

Gibbons
Gibbons are arboreal and spend less than 1% of their time on the ground, to keep safe from their ground-dwelling predators. They live in deciduous, evergreen, and tropical rain forests in southeast Asia. They can be found in the canopy of trees, as well as the highest branches of trees, and dwell in areas that are seasonally wet and consist of a lot of berries, fruits, and flowers.

Gibbons’ dentition is 2:1:2:3 and consists of one canine, two incisors, three molars, and two premolars. Their teeth are small, except for the canine, which is very long and sharp in both males and females.

Gibbons diet consists of fruit, leaves, insects, figs, and bird eggs, which explains why the majority of their teeth are small.

Lemurs
Lemurs live in the forests of Madagasgar, and cope with very seasonal environments, and can live in many different ecological niches due to Madagasgar’s harsh and seasonal climate.

Lemur detention consists of several tooth morphologies and is comes from a primate of the 2.1.3.3. dentition. In their toothcomb, their bottom incisors and canines face forward and are thinly spaced, which is used for grooming, feeding, or prying out seeds, cutting bark. Their toothcomb consists of four incisors and two canines, except indriids, monkey lemurs and sloth lemurs have four-toothcomb due to the loss of a canine or incisor. Lemurs are dentally precocious when they are born, and have full permanent dentition at weaning. The largest species of lemurs also have rapid dental development. They also have thin tooth enamel.

Because of their thin tooth enamel, lemurs often cause extra wear or breakage of their front teeth due to use for grooming, feeding and fighting. Lemurs use their lower teeth as combs to rake or scrape through fur. They use their teeth to discourage interaction with others, or even use them to slash others during fights. They rely on their teeth to tear through tough-skinned fruit. Their toothcomb is used along with their two grooming claws on their hind feet to comb through hair. They also eat fruit, leaves, flowers, insects, tree gum and sap.

After researching these five primates, I have realized that the environment directly influences their physical and behavioral traits. There is a reason for their canines and incisors, and a reason for toothcombs. Chimpanzees spend most of their time in trees, so therefore, most of their diet consists of things like fruits, nuts and leaves, which is why they have two incisors and one canine. Spider monkeys are foragers who also live in areas where there is logging and a lot of human disturbance, so they can eat leaves and flowers from the ground as well as bark and honey if they are in trees. Therefore, they don't need a lot of large teeth for those foods, but they do have big incisors for getting more difficult meals. Baboons spend a lot of time on the ground as well as in the trees, so they have large mouths and sharp incisors to catch prey like fish, birds, and insects. Gibbons spend hardly any time on the ground,and spend time at the highest of the tree tops so they have a smaller mouth with smaller incisors for eating insects, leaves, and figs. Lastly, lemurs can fit many different ecological niches and deal with harsh, seasonal climates so they eat a variety of small food. They also have to pay special attention to their fur which needs to be cleaned often, which results in their toothcomb. Therefore, the environment has a huge influence on physical and behavioral traits, and it's interesting to see how primates have adapted over time to work with these environments.

Analogy/Homology Blog Post

1. Homologous traits
a) Both chimpanzees and humans have opposable thumbs, which makes them different than other mammals on this earth.
b)The main difference in structure is that the chimpanzees’ thumbs are covered in hair and are smaller and a different color than humans’. Chimpanzees also use their thumbs to help them climb and pick food, whereas humans use it for things like driving cars, making food, holding cell phones, etc.
c) The common ancestor of the two species is Hominidae, which lived 14 million years ago. The ancestor possessed this homologous trait because it is made up of a taxonomic family which includes chimpanzees, gorillas, humans and orangutans, who all have opposable thumbs.
d)

2. Analogous trait
a)Both cats and dogs possess nails.
b) They both look similar, with their thin long nails. Both cats and dogs use their nails as tools: dogs use them for digging and cats use them for climbing and defending themselves.
c) The common ancestor between dogs and cats is called Maelestes gobiensis. There are little resources about this ancestor, as only the skull has been found, but they probably had nails of some sort. According to the Scientific American, the Maelestes gobiensis lived in the Gobi Desert over 70 million years ago. The shrew-like animal is an ancestor to all mammals. http://www.scientificamerican.com/podcast/episode.cfm?id=4B1665EC-E7F2-99DF-332752A3D3E23B03
d)

DNA Code

CCAATACCAAGGGAACGTCTGAAGTGCAAGCTTAATTTAAC

Thomas Malthus and his Contribution to Charles Darwin's Theory of Natural Selection

I believe that Thomas Malthus has the most influence over Darwin’s development of his natural selection theory. He wrote An Essay on the Principle of Population which proved to be very influential for natural selection theorists. He inferred that populations cannot grow exponentially forever, due to resource availability. According to Berkeley’s UCMP page, Malthus also said that humans, plants, and animals produce more offspring than can survive, due to a lack of resources. He also realized that the living conditions of humans were declining for several reasons: “The overproduction of young; the inability of resources to keep up with the rising human population; and the irresponsibility of the lower classes”. Malthus introduced the concept that all growing populations will struggle, because lack of resources will always be a problem.
The point that identifies with Malthus’ work is: “resources are limited”. As I said earlier, Malthus mentioned in his Essay on the Principle of Population that all populations suffer because they produce more offspring than there are resources. Populations increase exponentially, but the amount of food and other supplies generally is stable. For example, a population of bunnies would keep growing, but this would cause the population to start having trouble looking for food. The food they ate wouldn’t grow fast enough to keep up with the growing population of bunnies, and this would cause the bunnies to have difficulty finding food to eat.
This information had a positive effect on Darwin, as he expanded on that idea, in realizing that competition played a huge role in there being limited resources. Because of the limited availability of resources, populations will end up competing for the resources, which is a major part of the natural selection theory. Furthermore, Darwin drew from Malthus, that because there was struggle for existence, “favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The results of this would be the formation of a new species. Here, then I had at last got a theory by which to work". This direct quote from Charles Darwin’s autobiography shows that he wouldn’t have been able to develop his natural selection theory fully without the influence and ideas of Malthus. After reading his work, Darwin was able to add on to Malthus’ ideas, which helped him further his theory. Darwin expanded on Malthus’ ideas, in realizing that there would be competition for resources between individuals for resources to survive, and also that the populations and species that were equipped to survive would eventually form new species, while others would eventually become extinct.
During the Reform Movement, many atheists and socialists supported Jean-Baptiste Lamark’s ideas, and eventually ideas of evolution were seen as atheist. Therefore, the Church was very against Darwin’s views, which led to his delay in releasing On the Origin of Species. He still shared his opinions, even though the Church criticized him for it.
Darwin would not have been able to develop his theory of natural selection without the influence and ideas of Malthus. Darwin drew many ideas off of Malthus and used his work as a building block for Darwin’s ideas to prosper.
Overall, both Thomas Malthus and Charles Darwin discovered much about evolution and the ways of the world during their lifetimes. It has been very interesting for me to take a look at how Darwin drew off of Malthus ideas and was inspired by them to further add to his theories.