Analogy/Homology Blog Post

1. Homologous traits
a) Both chimpanzees and humans have opposable thumbs, which makes them different than other mammals on this earth.
b)The main difference in structure is that the chimpanzees’ thumbs are covered in hair and are smaller and a different color than humans’. Chimpanzees also use their thumbs to help them climb and pick food, whereas humans use it for things like driving cars, making food, holding cell phones, etc.
c) The common ancestor of the two species is Hominidae, which lived 14 million years ago. The ancestor possessed this homologous trait because it is made up of a taxonomic family which includes chimpanzees, gorillas, humans and orangutans, who all have opposable thumbs.
d)

2. Analogous trait
a)Both cats and dogs possess nails.
b) They both look similar, with their thin long nails. Both cats and dogs use their nails as tools: dogs use them for digging and cats use them for climbing and defending themselves.
c) The common ancestor between dogs and cats is called Maelestes gobiensis. There are little resources about this ancestor, as only the skull has been found, but they probably had nails of some sort. According to the Scientific American, the Maelestes gobiensis lived in the Gobi Desert over 70 million years ago. The shrew-like animal is an ancestor to all mammals. http://www.scientificamerican.com/podcast/episode.cfm?id=4B1665EC-E7F2-99DF-332752A3D3E23B03
d)

DNA Code

CCAATACCAAGGGAACGTCTGAAGTGCAAGCTTAATTTAAC

Thomas Malthus and his Contribution to Charles Darwin's Theory of Natural Selection

I believe that Thomas Malthus has the most influence over Darwin’s development of his natural selection theory. He wrote An Essay on the Principle of Population which proved to be very influential for natural selection theorists. He inferred that populations cannot grow exponentially forever, due to resource availability. According to Berkeley’s UCMP page, Malthus also said that humans, plants, and animals produce more offspring than can survive, due to a lack of resources. He also realized that the living conditions of humans were declining for several reasons: “The overproduction of young; the inability of resources to keep up with the rising human population; and the irresponsibility of the lower classes”. Malthus introduced the concept that all growing populations will struggle, because lack of resources will always be a problem.
The point that identifies with Malthus’ work is: “resources are limited”. As I said earlier, Malthus mentioned in his Essay on the Principle of Population that all populations suffer because they produce more offspring than there are resources. Populations increase exponentially, but the amount of food and other supplies generally is stable. For example, a population of bunnies would keep growing, but this would cause the population to start having trouble looking for food. The food they ate wouldn’t grow fast enough to keep up with the growing population of bunnies, and this would cause the bunnies to have difficulty finding food to eat.
This information had a positive effect on Darwin, as he expanded on that idea, in realizing that competition played a huge role in there being limited resources. Because of the limited availability of resources, populations will end up competing for the resources, which is a major part of the natural selection theory. Furthermore, Darwin drew from Malthus, that because there was struggle for existence, “favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The results of this would be the formation of a new species. Here, then I had at last got a theory by which to work". This direct quote from Charles Darwin’s autobiography shows that he wouldn’t have been able to develop his natural selection theory fully without the influence and ideas of Malthus. After reading his work, Darwin was able to add on to Malthus’ ideas, which helped him further his theory. Darwin expanded on Malthus’ ideas, in realizing that there would be competition for resources between individuals for resources to survive, and also that the populations and species that were equipped to survive would eventually form new species, while others would eventually become extinct.
During the Reform Movement, many atheists and socialists supported Jean-Baptiste Lamark’s ideas, and eventually ideas of evolution were seen as atheist. Therefore, the Church was very against Darwin’s views, which led to his delay in releasing On the Origin of Species. He still shared his opinions, even though the Church criticized him for it.
Darwin would not have been able to develop his theory of natural selection without the influence and ideas of Malthus. Darwin drew many ideas off of Malthus and used his work as a building block for Darwin’s ideas to prosper.
Overall, both Thomas Malthus and Charles Darwin discovered much about evolution and the ways of the world during their lifetimes. It has been very interesting for me to take a look at how Darwin drew off of Malthus ideas and was inspired by them to further add to his theories.